Tutorial 3 - BLAST, Star Alignment, Clustal Omega

Problem 1 - Multiple Sequence Alignment Score

Calculate the score of the following alignment

  1. using sum-of-pairs method (match is $+4$, mismatch $-2$, indel $-1$ and $s(\_,\_)=0$);
  2. using Shannon entropy method.

$$\begin{array}{l} \mathtt{MQPILL\_G} \\ \mathtt{MLR\_LL\_G} \\ \mathtt{MK\_ILLL\_} \\ \mathtt{MPPVLLI\_} \end{array}$$

Calculate the consensus sequence.

[Adapted from http://www.bii.a-star.edu.sg/docs/education/lsm5192_04/Multiple%20Sequence%20Alignment%20Progressive%20Approaches.pdf. ]

Problem 2 - STAR Alignment

Calculate multiple sequence alignment using the star approach.

$$\begin{aligned} s_1 &= \mathtt{CCTGCTGCAG} \\ s_2 &= \mathtt{GATGTGCCG} \\ s_3 &= \mathtt{GATGTGCAG} \\ s_4 &= \mathtt{CCGCTAGCAG} \\ s_5 &= \mathtt{CCTGTAGG} \end{aligned}$$ Match is for $+1$, mismatches and indels for $-1$.

The following code may help you to calculate the pairwise alignments.

R

source("https://bioconductor.org/biocLite.R")
biocLite("Biostrings")

library(Biostrings)
s1 <- "CCTGCTGCAG"
s2 <- "GATGTGCCG"
s3 <- "GATGTGCAG"
s4 <- "CCGCTAGCAG"
s5 <- "CCTGTAGG"

submatrix <- nucleotideSubstitutionMatrix(match = 1, mismatch = -1, baseOnly = TRUE)


pairwiseAlignment(s1, s2, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s1, s3, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s1, s4, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s1, s5, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s2, s3, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s2, s4, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s2, s5, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s3, s4, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s3, s5, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s4, s5, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)

Problem 3 - CLUSTAL

Align group $$\begin{aligned} s_1 &= \mathtt{ATTGCCATT\_\_} \\ s_2 &= \mathtt{ATC\_CAATTTT} \end{aligned}$$ with group $$\begin{aligned} s_3 &= \mathtt{ATGGCCATT} \\ s_4 &= \mathtt{ATCTTC\_TT} \end{aligned}$$ using the approach of CLUSTALW algorithm. Align groups based on two most similar sequences considering matches for $+1$ and mismatches and gaps for $-1$. The respective guiding tree is below.

[Source http://www.bii.a-star.edu.sg/docs/education/lsm5192_04/Multiple%20Sequence%20Alignment%20Progressive%20Approaches.pdf. ]

The following code may help you to decide which two sequences will guide the alignment.

R

source("https://bioconductor.org/biocLite.R")
biocLite("Biostrings")

library(Biostrings)
s1 <- "ATTGCCATT"
s2 <- "ATCCAATTTT"
s3 <- "ATGGCCATT"
s4 <- "ATCTTCTT"


submatrix <- nucleotideSubstitutionMatrix(match = 1, mismatch = -1, baseOnly = TRUE)


pairwiseAlignment(s1, s3, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s1, s4, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s2, s3, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)
pairwiseAlignment(s2, s4, substitutionMatrix = submatrix, gapOpening = 0,gapExtension = -1, scoreOnly = FALSE)

Problem 4 - BLAST

Use BLAST algorithm to find the local alignment of query sequence $$ \mathtt{IHNWALN} $$ in database $$ \mathtt{AFGIAAAHDWALNW}. $$ Use $k=3$, a threshold for high scoring words $T=20$, and BLOSUM 62 scoring matrix.

Problem 5 - BLAST online

Use NCBI BLAST page to find what species are likely to contain those sequences in their DNA.

AAAACCGCTGATGAGCGTCGGTAAAGTACTGAATATGAACAACATCGCGGCAGCCGGCATGGTGGCAACGCTTGCCAACA
ACATCCCGATGTTCGGCATGATGAAGCAGATGGATACCCGCGGCAAAGTCATCAACTGCGCCTTCGCCGTTTCCGCTGCT
TTCGCCCTGGGCGACCACTTAGGCTTCGCCGCTGCCAACATGAACGCCATGATCTTCCCGATGATTGTCGGCAAGTTGAT
CGGCGGCGTAACGGCGATTGGCGTGGCGATGATGCTGGTGCCAAAAGAAGACGCGACCGCGACTAAAACCGAAGCGGAGG
CACAATCGTGAACACTCGCCAGCTATTGAGCGTCGGTATCGATATCGGCACCACCACCACCCAGGTGATTTTCTCCCACC
TGGAGCTGGTTAACCGTGCGGCGGTGTCGCAGGTGCCGCGCTACGAATTCATTAAACGCGAAATTAGCTGGCAAAGTCCG
GTGTTCTTTACCCCTGTCGATAAACAGGGCGGTTTAAAAGAAGCGGAACTGAAAACCTTAATACTCGAGCAATATCAGGC
TGCGGGTATTGCGCCGGAAAGCGTTGATTCTGGTGCCATCATCATCACCGGTGAAAGCGCGAAAACCCGCAATGCTCGCC
CGGCGGTGATGGCGCTCTCTCAATCGCTGGGGGATTTTGTCGTTGCCAGCGCCGGGCCGCACCTCGAATCCGTGATCGCC
GGTCACGGAGCTGGGGCGCAAACCCTTTCTGAACAACGGCTGTGTCGGGTACTGAATATCGACATCGGCGGTGGCACCGC
GAACTACGCCCTGTTCGATGCCGGAAAAATCAGCGGCACTGCCTGTCTCAACGTCGGTGGTCGCCTGCTGGAAACCGACA
GCCAGGGGCGCGTGGTTTACGCTCATAAACCGGGGCAGATGATTGTGGATGAGTGCTTCGGTGCAGGCACTGACGCCCGT
TCGCTGACCGGCGCGCAGCTGGTGCAGGTTACCCGGCGGATGGCGGCGCTGATTGTCGAAGTGATTGACGGAACGCTTTC
GCCGCTCGCGCAGGCATTGATGCAAACCGGTTTGCTGCCCGCAGGTGTTACGCCCGAAATCATTACGCTTTCTGGAGGCG
TGGGCGAATGTTATCGCCACCAGCCCGCCGACCCGTTCTGTTTTGCCGATATTGGCCCACTTCTGGCAACGGCGCTGCAT
GACCATCCGCGCCTGCGTGAGATGAATGTGCAGTTTCCGGCGCAAACCGTACGCGCCACGGTGATTGGCGCGGGTGCACA
TACCCTTTCGCTCTCTGGCAGCACAATCTGGCTGGAGGGCGTACAACTGCCGCTGCGCAATTTGCCGGTGGCGATCCCGA
TTGATGAAACGGATCTGGTGAGTGCCTGGCAACAGGCGCTGCTTCAGCTGGATCTTGATCCCAAAACTGACGCGTACGTG
CTGGCGCTTCCCGCCTCGCTGCCTGTGCGTTACGCCGCGGTACTGACGGTCATCAACGCGCTGGTCGATTTCGTCGCGCG
TTTTCCGAATCCGCATCCCCTGCTGGTGGTGGCCGGGCAGGACTTTGGTAAAGCTCTGGGCATGTTGTTGCGCCCACAGC
TACAACAACTCCCGTTGGCAGTCATTGACGAAGTGATTGTCCGCGCGGGGGACTATATCGACATTGGTACGCCTCTTTTT
GGCGGATCGGTTGTGCCGGTGACGGTGAAATCACTCGCATTTCCTTCCTGAGGGAACGACTTATGAAACTAAAGACCACA
TTGTTCGGCAATGTATATCAGTTTAAGGATGTAAAAGAGGTGCTGGCTAAAGCCAACGAACTGTGTTCGGGGGATGTGCT
GGCAGGCGTTGCAGCGGCAAGTTCACAGGAGCGCGTGGCGGCAAAGCAGGTGTTGTCGGAAATGACCGTAGCGGACATCC
GCAATAATCCGGTGATTGCCTATGAAGATGACTGCGTGACGCGGCTGATTCAGGACGATGTTAACGAAACGGCCTACAAC

CCACAAGACGTCAAGTTTCCGGGCGGCGGCCAGATCGTTGGCGGAGTATACTTGCTGCCGCGCAGGGGCCCCAGGTTGGG
TGTGCGCGCGGCAAGGAAAACTTCGGAGCGGTCACAGCCCCGTGGGAGACGCCAGCCCATCCCCAAAGATCGGCGTCCCA
CTGGCAAGTCCTGGGGAAAACCAGGATACCCTTGGCCCTTATATGGGAACGAGGGGCTCGGCTGGGCAGGATGGCTCCTG
TCCCCCCAGGGCTCCCGTCCCTCTTGGGGCCCCACTGACCCCCGGCGTAGGTCGCGCAATGTGGGTAAGGTCATCGACAC
CCTAACGTGCGGCTTCGCCGACCTCATGGGGTACATCCCCGTCGTAGGCGCCCCGCTTGGCGGTGTCGCCAGAGCTCTCG
CGCATGGCGTGAGGGCCCTGGAGGACGGGGTCAACTATGCAACAGGGAACTTACCCGGTTGCCCCTTTTCTATCTTCTTG
CTGGCCCTACTGTCCTGCATCACCACTCCGGTCTCAGCTGCCCAGGTGAAAAACACCAGTGACATCTACATGGTGACTAA
CGACTGTCCCAACAGCAGCATCACCTGGCAGCTTAGGGCCGCAGTCCTCCACGTCCCCGGATGTGTCCCGTGTGAGAAAG
TGGGGAATACATCTCAGTGCTGGACGCCGGTCTCACCCAATGTGGCTGTGCAGCAACCCGGCGCCCTCACGCGGGGCTTG
CGGACGCACATCGATATCGTTGTAATGTCCGCTACGCTCTGCTCCGCTCTCTATGTGGGGGACCTCTGCGGCGGGGTAAT
GCTCGCGGCCCAGATATTCATCGTCTCGCCACAACACCACTGGTTCGTGCAAGAGTGCAATTGCTCCATCTACCCTGGTA
CCATCACTGGTCACCGTATGGCATGGGACATGATGATGAACTGGTCGCCCACAGCTACCATGATCCTGGCGTACGCGACA
CGTGTTCCCGAGGTCATCATAGACATCATTAGCGGGGCTCACTGGGGTGTCATGTTCGGCCTGGCCTACTTCTCTATGCA
GGGAGCGTGGGCGAAGGTCGTTGTCATCCTCCTGCTGGCCGCTGGGGTGGACGCACATACCAACGTCATTGGGGCCCAGG
TGGGGCGCACCGCCAGTAGCCTTAATAGCTTGTTCACCGTCGGCGCTAAGCAGAACATCCAGCTGATCAACTCCAATGGC
AGTTGGCACATCAACCGCACTGCTCTGAACTGCAATGACTCTCTGAACACCGGCTTCCTCGCGTCCCTGTTCTACACCAA
TCGCTTCAACTCGTCGGGATGCCCAGAACGTCTGGCATCCTGCCGTAGGATTGAGGCCTTCAGGATAGGATGGGGCACTC
TGCAATATGAGCACAATGTCACCAATTCAGAGGATATGAGACCATACTGCTGGCATTATCCACCCAAACCTTGTGGTATA
GTCCCCGCGAGGTCTGTGTGTGGCCCGGTGTACTGTTTCACACCCAGCCCAGTAGTAGTGGGCACGACCGACAGGCGTGG
AGTGCCCACTTACACGTGGGGGGAGAATGAGACGGACGTCTTCCTACTGAACAGCACCCGGCCACCGCGGGGGTCATGGT
TCGGCTGTACGTGGATGAACTCCACTGGCTTCACCAAGACTTGTGGCGCACCACCTTGCCGCATTAGAGCTGATTTCAAT
GCCAGCACGGACCTGTTGTGCCCCACGGACTGTTTTAGGAAACACCCTGACGCCACTTACATCAAGTGTGGCTCCGGGCC
CTGGCTCACGCCCAGATGCCTGGTCGACTACCCCTACAGGCTCTGGCACTACCCCTGCACAGTCAACTATAGCATCTTCA
AGATAAGGATGTACGTGGGGGGGGTTGAACACAGGCTTACAGCTGCCTGTAACTTCACCCGCGGGGATCCTTGCAACTTG
GATGACAGAGACAGAAGTCAACTGTCCCCCTTGTTGCACTCTACCACGGAGTGGGCCATCTTGCCCTGCACTTACTCTGA
CCTGCCCGCCTTGTCGACCGGTCTCCTCCACCTCCACCAAAACATCGTGGACGTGCAATACATGTACGGCCTTTCACCAG
CCGTCACGAAGTACATAGTCCGGTGGGAGTGGGTAGTGCTCTTGTTCCTGCTCTTGGCGGACGCCAGGGTCTGTGCCTGT
GTATGGATGCTCATCCTGCTGGGCCAAGCCGAGGCAGCCCTAGAGAAGCTGGTTGTTTTGCACGCCGCGAGTGCGGCTGG
CTGCAATGGCTTTCTATATTTCATCATCTTTTTCGTGGCTGCGTGGTGCATCAAGGGTCGAGTGGTCCCCTTGGCTACCT
ATTCCCTCATCGGCCTATGGTCCTTCTTCCTACTGCTCCTAGCATTGCCTCAACAGGCTTATGCTTATGATGCAACTGTG
CATGGACAAATAGGCGTGGCCCTGTTGGTGCTGCTCACCCTCTTTACACTCACCCCGGCATATAAGACCCTCCTGGGCCG
GTGTCTGTGGTGGCTGTGCTATCTCCTGACCTTGGGAGAGGCCCTCGACCAGGAGTGGGCACCCTCCATGCAGGCGCGCG
GTGGCCGGGATGGCATCATATGGGCTGCCACCATATTCTGCCCGGGTGTGGTGTTTGACATAACCAAGTGGCTTTTGGCG
ATACTTGGACCTGGTTATCTCCTAAGAGATGCTTTGACACGCGTGCCGTATTTCGTCAGAGCCCACGCTCTGCTGAGAAT
GTGCGCCATGGTGATGCACCTCGTGGGGGGTAAGTACGTCCAGATGGCGCTATTAACCCTTGGTAGGTGGACTGGCACTT
ACATCTACGACCACCTCGCCCCCATGTCGGATTGGGCTGCCAGCGGCCTGCGGGACCTGGCGGTCGCTGTGGAACCTATC
ATCTTCAGTCCGATGGAGAAAAAAGTCATCGTATGGGGAGCGGAGACAGCCGCGTGCGGGGACATCTTGCACGGACTTCC
CGTGTCTGCTCGGCTTGGTCGAGAGATCCTTCTTGGCCCAGCTGACGGCTACACCTCTAAGGGGTGGAAGCTTCTTGCGC
CTATCACTGCTTATGCCCAGCAGACACGAGGTCTCTTGGGCGCCATAGTGGTGAGCATGACAGGCCGTGACAAAACGGAA
CAGGCCGGGGAGATCCAAGTCCTGTCCACGGTCACTCAGACCTTCCTCGGAACTACCATCTCAGGGGTCTTATGGACCGT
CTACCACGGAGCTGGCAACAAGACCTTAGCCGGTTCGCGGGGCCCGGTCACGCAGATGTACTCCAGTGCCGAGGGAGACT
TGGTGGGGTGGCCCAGTCCCCCCGGGACCAAATCCATGGAGCCGTGCACATGCGGAGCGGTCGACCTGTATCTGGTCACG
CGGAACGCTGATGTCATCCCGGCTCGGAGACGCGGGGACAAGCGGGGAGCGTTGCTCTCCCCGAGACCTCTCTCGACCTT
GAAGGGGTCCTCAGGGGGACCGGTGCTTTGCCCCAGGGGCCACGTTGTTGGGATCTTCCGGGCAGCCATATGCTCTCGGG
GCGTGGCCAAGTCCATAGACTTCATCCCCGTTGAGATGCTTGACATCGTCACGCGCTCCCCCACCTTTACCGACAACAGC

GCTTCTGTCTAGTTTTTATATGAAGATATTCCCATTTCCAATGACGGCCTCAAAGCAGTCCAAATATCCACTTGCAGATT
ATAAGAAAAGAGTGTTTCAAAATTGCTCTATGAAAAGGGAAGTTTAACTCTGTGAGTTGAATGCAAACATCACAAAGAAG
TTTCTGACAATGCTTCTGTCTAGTTTTTATTTATAGATATTTCCTTTTCCACCATAGGCCTCCAAGCTCTCCAAATGTCT
GCTTGCAGATTCTACAAAAAAAGTGCTTCAAACCTGCTCTATCAAAAGAAAGGTTCAATTCTGTGAGTGGAATGCACACA
TCACAAAGAGATTTCTGAGAATGATTCTGTCTAGTGTTTATGTGAAGATATCCCCTTTTCCAACGAAGGCCTCAAAGCGG
TTCAAATATCCACTTGCAGATTCTGCAAAAAGAGTGCTTCAAAACTGCTCTATGAAGAGGTATGTTCAACCCTGTGATTT
GAAAGCACACATCATAAAGTAGTTCCGAAGAATTATTCTGTCTGGTTTTTATATAATGATATTTCCTTTTCCATCATAGG
CCTCAAAGCTCGCCATATGTCCACTTGAAGATTCTACAAAAAGACGGTTTCAAACCTGCTCTATGAAAAGAAAGGTTCAA
CTCTGTGAGTTGAATGCACACATCACAAAGCAGTTTCTGAGAATGCTTCTGTCTAGTGTTTATGTGAAGATAATCCCGTT

All sequences come from different taxonomic kingdoms. Where can you find the bacteria? Why is it so important for bioinformatics and biologists? What was the length of the portion of the virus DNA presented on this page? Compare length of the genome with the other organisms?

Mammals have more than a single chromosome. The count range can be found on this Wikipedia page. Which chromosome does the sequence come from? What is the similarity reported by BLAST? What may be biological motivation for such a thing? How does this influence sequence assembly?

courses/bin/tutorials/tutorial3.txt ยท Last modified: 2019/03/06 12:58 by rysavpe1