Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
courses:bin:tutorials:tutorial3 [2019/03/04 09:27]
rysavpe1 [Problem 3 - CLUSTAL]
courses:bin:tutorials:tutorial3 [2019/03/06 12:58] (current)
rysavpe1 [Problem 5 - BLAST online]
Line 193: Line 193:
 CTCTGTGAGTTGAATGCACACATCACAAAGCAGTTTCTGAGAATGCTTCTGTCTAGTGTTTATGTGAAGATAATCCCGTT CTCTGTGAGTTGAATGCACACATCACAAAGCAGTTTCTGAGAATGCTTCTGTCTAGTGTTTATGTGAAGATAATCCCGTT
 </​code>​ </​code>​
 +
 +<​note>​
 +All sequences come from different taxonomic kingdoms. Where can you find the
 +bacteria? Why is it so important for bioinformatics and biologists? What was the
 +length of the portion of the virus DNA presented on this page? Compare length of
 +the genome with the other organisms?
 +
 +Mammals have more than a single chromosome. The count range can be found
 +on [[https://​en.wikipedia.org/​wiki/​List_of_organisms_by_chromosome_count|this Wikipedia page]].
 +Which chromosome does the sequence come from? What is the similarity reported
 +by BLAST? What may be biological motivation for such a thing? How does this
 +influence sequence assembly?
 +</​note>​
courses/bin/tutorials/tutorial3.txt ยท Last modified: 2019/03/06 12:58 by rysavpe1